Skip to contentSkip to top navigationSkip to sub navigation Marian Koshland Science Museum of the National Academy of Sciences
Site Map Contact Us
Search
Home Visitor Info Background Exhibits Teachers Events Media
Putting DNA to Work
  DNA/CRIMINAL JUSTICE

Catch A Criminal - Text Only Version

Three suspects. One sample of DNA evidence. Find out how DNA can be used to catch a criminal.

This activity simulates the process by which DNA evidence is used to identify suspected criminals using the FBI's DNA identification system, CODIS...

How Can DNA Sequences Identify Individuals?

Most people share very similar gene sequences, but some regions of DNA sequence have been found to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the question of whether two different DNA samples come from the same person.

The FBI's forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats (GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats (GATAGATAGATAGATAGATA) from their mother.

When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI's CODIS system, the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification extremely reliable.

SUSPECT 1

Compare the DNA evidence from the crime scene (SAMPLE) to the DNA profiles of the suspects using CODIS sites. When DNA samples match completely at the 13 regions used in the FBI's CODIS system, the probability that they could have come from two unrelated people is virtually zero.

Suspect 1 matches the evidence in 5 of the 26 sites. Suspect 1 is not an exact match.

SUSPECT 2

Compare the DNA evidence from the crime scene (SAMPLE) to the DNA profiles of the suspects using CODIS sites. When DNA samples match completely at the 13 regions used in the FBI's CODIS system, the probability that they could have come from two unrelated people is virtually zero.

Suspect 2 matches the evidence in 11 of the 26 sites. Suspect 2 is not an exact match.

SUSPECT 3

Compare the DNA evidence from the crime scene (SAMPLE) to the DNA profiles of the suspects using CODIS sites. When DNA samples match completely at the 13 regions used in the FBI's CODIS system, the probability that they could have come from two unrelated people is virtually zero.

Suspect 3 matches the evidence in 26 or the 26 sites. Suspect 3 is an exact match.

Whose DNA is it?

Only the perpetrator, Suspect 3, could be a perfect match. Surprisingly, the closest blood relatives, such as two siblings or a parent and child, are unlikely to match even half of the sites. Suspect 2, the perpetrator's brother, matched at only 11 of the 26 sites. Strangers are unlikely to match at more than a few sites.

What does a match mean?

DNA identification is based on probabilities. Consider the case of just three CODIS sites. The probability that someone would match a random DNA sample at any one site is roughly one in ten (1/10). So the probability that someone would match at three sites would be about one in a thousand: 1/10 x 1/10 x 1/10 = 1/1000 Applying this probability equation to all 13 CODIS sites would mean that the chances of matching a random DNA sample are about one in ten trillion: 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x = 1/10,000,000,000,000 Actual probabilities vary, depending on several factors. But the probability of two different people matching at all 13 CODIS sites is virtually zero.


Back to DNA/Criminal Justice

 

Print this Page

The National Academies - Advisers to the Nation on Science, Engineering, and Medicine Back to Top